Primer designer

Picks a matched forward and reverse primer for a pasted template.

Best primer pair

How to design PCR primers from a template

Paste the template strand, 5’ to 3’. With nothing else set, the tool looks for a forward primer in the first 60 bases and a reverse primer in the last 60 bases, so the product covers almost the whole sequence you pasted. That is what you want when the pasted sequence isthe thing to amplify, a gene or an insert. To amplify a part of a longer sequence, type the first and last base of the region that must end up inside the product; the tool then searches up to 150 bases outside each edge of that region.

The rules a primer has to pass

PropertyAcceptedWhy
Length18–25 ntLong enough to be specific, short enough to anneal cleanly and stay cheap.
GC content35–65 %Below that the primer is unstable, above it the template is hard to melt open.
3’ GC clamp1–3 G or C in the last 5One or two strong pairs anchor the 3’ end; four or five make mispriming stable.
Base runsno run of 5AAAAA or GGGGG slips on repetitive template.
Tm of the pairwithin 3 °COne annealing temperature has to suit both primers.
3’ complementaritypenalisedTwo 3’ ends that pair with each other make primer dimer instead of product.

Worked example

The built-in example is a 468 base preproinsulin CDS with flanking sequence. With no target region and a target Tm of 60 °C the tool returns:

Forward GAGGCCATCAAGCAGGTCTGTTC · 23 nt · GC 56.5 % · Tm 60.0 °C · bases 16–38
Reverse ATTCCATCTCTCTCGGTGCAGGAG · 24 nt · GC 54.2 % · Tm 60.0 °C · bases 428–451
Product 436 bp

The two Tm values are 0.0 °C apart, the product is 64.4 % GC, and a single annealing temperature of about 55 °C (5 °C below the lower Tm) suits both primers. The reverse primer is written the way it is ordered, 5’ to 3’ on the bottom strand, which is the reverse complement of bases 428 to 451 of the sequence you pasted. Four more pairs, most of them sharing that reverse primer, sit behind Details.

How the melting temperature is calculated

Tm = ΔH ÷ (ΔS + R · ln(C ÷ 4)) − 273.15, then corrected for salt

ΔH and ΔS are summed over the nearest-neighbour pairs of the primer using the SantaLucia unified parameters, and the result is corrected to 50 mM Na⁺ with the Owczarzy relation at an oligo concentration of 250 nM. Those are the defaults of theTm calculator on this site, so a primer from here pasted there gives the same number. If your PCR buffer contains Mg²⁺, and it does, enter it in the Tm calculator: the real Tm in the reaction is a few degrees higher than the figure quoted here.

What to do before you order

  • Check specificity. BLAST both primers against the genome or plasmid you will actually amplify. This tool only sees what you pasted.
  • Check dimers and hairpins. Paste the pair into theprimer dimer and hairpin checker; the score here only penalises 3’ end overlaps.
  • Check the product. The PCR product tool finds every place the pair binds and the size of every amplicon it would make, andprimer map draws the binding sites.
  • Set the cycling conditions. Theextension time and annealing calculator turns the Tm and the product length into a program.

When the tool says it cannot find a pair

Three things cause that. The template may be too short: each end needs at least 18 usable bases outside the target region. The windows may be full of ambiguity codes, which are never built into a primer. Or the region may be so AT rich or GC rich that nothing reaches the target Tm, in which case lower or raise the target Tm by a few degrees, or shift the target region. When the usual rules find nothing, the tool relaxes the GC and clamp limits once and says so above the result.

Frequently asked questions

How does this primer designer choose a pair?

It lists every substring of 18 to 25 bases in the window at each end of the amplicon, drops the ones with unsuitable GC content, a missing 3’ GC clamp or a run of five identical bases, and scores the rest on how close the nearest-neighbour Tm is to the target. Forward and reverse candidates are then paired, penalised for the difference between their Tm values and for complementarity between their 3’ ends, and the best-scoring pair is shown. The next four are under Details.

What Tm does it report?

The nearest-neighbour Tm from the SantaLucia unified parameters with the Owczarzy salt correction, at 50 mM Na+ and 250 nM oligo, exactly the defaults of the Tm calculator on this site. Paste a designed primer there to change the salt or the oligo concentration; the number for the same conditions will match.

Does it check that the primers are unique in my genome?

No. It only sees the sequence you paste, so it cannot know whether a primer also binds somewhere else in a genome or a plasmid. Run the pair through BLAST or an in silico PCR tool against the real template before ordering. Uniqueness is the single most common reason a well-designed pair still fails.

Why is there no primer longer than 25 bases?

Because above that, length stops buying specificity and starts costing money, yield and annealing behaviour. Most PCR primers are 18 to 25 bases with a Tm near 60 degrees. If a region is so AT rich that no 25-mer reaches the target Tm, lower the target Tm rather than lengthening the primer, or move the window by setting a target region.

Can I add restriction sites or tails to the primers?

Add them yourself to the sequences the tool gives you, at the 5’ end, and do not include the tail when you calculate the annealing temperature for the first few cycles. A 5’ tail does not anneal to the template in cycle one, so the first two or three cycles should use the annealing temperature of the bare primer.