PCR extension time and annealing
Annealing temperature from the primers, extension time from the product length.
Annealing temperature from the primers, extension time from the product length.
The extension step has to be long enough for the polymerase to copy the whole product once. Every enzyme has a published speed, quoted as seconds per kilobase, so the time follows directly:
| Polymerase | Speed | Denaturation | Annealing rule |
|---|---|---|---|
| Taq | 60 s/kb | 95 °C | lower Tm − 5 °C |
| OneTaq | 60 s/kb | 94 °C | lower Tm − 5 °C |
| Pfu | 120 s/kb | 95 °C | lower Tm − 5 °C |
| Phusion | 30 s/kb | 98 °C | lower Tm + 3 °C |
| Q5 | 30 s/kb | 98 °C | lower Tm + 3 °C |
Phusion is specified at 15 to 30 s/kb and Q5 at 20 to 30 s/kb; the calculator uses the slower, safer end. The plus 3 °C rule for Phusion and Q5 applies when both primers are longer than 20 bases, which is NEB's own guidance; with a shorter primer the lower Tm is used unchanged.
The built-in example is a pair of primers, GAGGCCATCAAGCAGGTCTGTTC andATTCCATCTCTCTCGGTGCAGGAG, a 1,000 bp product and Taq. Both primers melt at60.0 °C, so the lower Tm is 60.0 and the annealing temperature is 60.0 − 5 =55 °C. The product is 1.0 kb and Taq runs at 60 s/kb, so the extension step is1 min. The full program is 95 °C for 30 s, then 30 cycles of 95 °C for 30 s, 55 °C for 30 s and 72 °C for 1 min, then 72 °C for 5 min and a hold at 4 °C.
On the primer sequences tab the Tm comes from the nearest-neighbour model with the SantaLucia parameters and a salt correction for 50 mM Na⁺ at 250 nM oligo, the same settings as theTm calculator on this site. A supplier's own calculator may assume its own buffer and give a Tm a degree or two different, so if you are following NEB's plus 3 rule to the letter, feed it NEB's Tm. If you already have melting temperatures from elsewhere, switch to the Primer Tm tab and type them in.
Annealing temperature is the first thing to change when a reaction misbehaves. Too low and the primers bind at partly matched sites, giving extra bands or a smear; too high and there is no product at all. A gradient of plus and minus 3 °C around the calculated value settles it in one run.
Design or check the primers with the primer designer, confirm the product size with PCR product size, rule outprimer dimers and hairpins, and scale the reagents with the master mix calculator.
Multiply the length of the product by the speed of the polymerase. Taq and OneTaq copy about 1000 bases a minute, Pfu about 500, and the fast proofreading enzymes Phusion and Q5 manage a kilobase in 15 to 30 seconds. The calculator rounds the answer up to a tidy cycler setting and never goes below 10 seconds, because the block needs time to reach 72 degrees.
For Taq, OneTaq and Pfu, about 5 degrees below the lower of the two primer melting temperatures. For Phusion and Q5, NEB recommends 3 degrees above the lower Tm when both primers are longer than 20 bases, and the lower Tm itself when either is shorter. These are starting points: if the first run gives a weak or smeared product, repeat it as a gradient of plus and minus 3 degrees.
Because one annealing step has to serve both. If the two Tm values differ by more than about 5 degrees, the temperature that lets the cooler primer bind also lets the warmer one bind in the wrong places, and the temperature that keeps the warmer one specific leaves the cooler one mostly unbound. Lengthen the cooler primer or shorten the warmer one until they agree.
Some. Extra time at 72 degrees is extra time for the polymerase to add non-templated bases, to copy mispriming products and, with a proofreading enzyme in a reaction with little template, to chew back the primers. Doubling the recommended time is a reasonable rescue for a stubborn long product; leaving it at ten times the needed value is not.
Thirty is the usual figure for plasmid or genomic template. Use 25 when the template is abundant, such as a plasmid miniprep or a previous PCR product, and up to 35 for single-copy targets in genomic DNA. Beyond 35 the reaction is out of dNTPs or primers and each extra cycle mostly amplifies artefacts.